Detail of EST/Unigene AB049577 |
Acc. | AB049577 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-93; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=3e-81; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-77; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=9e-75; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-74; |
Length | 2426 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | MT_CDS (1 ESTs); |
Sequence | ATCCAATTCTCTCTCCGCCCTACCTATAGCATAAAAACCAACCAATAGAAAAACAAATAA |
EST members of Unigene | AB049577 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |