| Detail of EST/Unigene AB049577 |
| Acc. | AB049577 |
| Internal Acc. | |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-93; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=3e-81; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-77; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=9e-75; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-74; |
| Length | 2426 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | MT_CDS (1 ESTs); |
| Sequence | ATCCAATTCTCTCTCCGCCCTACCTATAGCATAAAAACCAACCAATAGAAAAACAAATAA |
| EST members of Unigene | AB049577 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |