| Detail of EST/Unigene AF537205 |
| Acc. | AF537205 |
| Internal Acc. | |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=0; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=2e-79; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=3e-73; Fructan 6-exohydrolase OS=Beta vulgaris E-value=1e-72; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=2e-67; |
| Length | 714 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS (1 ESTs); |
| Sequence | GACACAAAACATGATCACTATTTGATTGGGACTTATGATACTGTTAAGGATGTTTTTGTT |
| EST members of Unigene | AF537205 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2552.1.S1_at
|
| Corresponding NCBI Gene | 820591 |
| Trichome-related Gene from Literature | N/A |