Detail of EST/Unigene AF537205 |
Acc. | AF537205 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=0; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=2e-79; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=3e-73; Fructan 6-exohydrolase OS=Beta vulgaris E-value=1e-72; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=2e-67; |
Length | 714 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS (1 ESTs); |
Sequence | GACACAAAACATGATCACTATTTGATTGGGACTTATGATACTGTTAAGGATGTTTTTGTT |
EST members of Unigene | AF537205 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2552.1.S1_at
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |