Detail of EST/Unigene AI775627 |
Acc. | AI775627 |
Internal Acc. | EST256727 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=5e-08; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=1e-07; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=2e-07; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=7e-07; |
Length | 350 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_RES (1 ESTs); |
Sequence | GGAAGGCCATGTATAGAGAAGCTAAAGAGTGTGTTTACGTCGAGCCAGATGAAGGTGACC |
EST members of Unigene | AI775627 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |