Detail of EST/Unigene AI778224 |
Acc. | AI778224 |
Internal Acc. | EST259103 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=1e-51; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=2e-49; Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=3e-40; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=2e-39; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=1e-36; |
Length | 521 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SUS_LEAF (1 ESTs); |
Sequence | TGGTAGTGAAAGTGTATGGTTCAGCAATGGCTGCATGTCCACAAAGGGTCATGGTTTGTC |
EST members of Unigene | AI778224 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831586 |
Trichome-related Gene from Literature | 831586 |