Detail of EST/Unigene AI898816 |
Acc. | AI898816 |
Internal Acc. | EST268259 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=8e-59; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=3e-58; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=4e-56; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=2e-54; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=3e-54; |
Length | 409 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TAMU (1 ESTs); |
Sequence | GTGGAGCTAGTACAACCTAAATGGTACGAGAGGTTGTTAGTTATTGCTGTGCAGGGAGTC |
EST members of Unigene | AI898816 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |