| Detail of EST/Unigene AI898816 |
| Acc. | AI898816 |
| Internal Acc. | EST268259 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=8e-59; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=3e-58; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=4e-56; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=2e-54; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=3e-54; |
| Length | 409 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TAMU (1 ESTs); |
| Sequence | GTGGAGCTAGTACAACCTAAATGGTACGAGAGGTTGTTAGTTATTGCTGTGCAGGGAGTC |
| EST members of Unigene | AI898816 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836542 |
| Trichome-related Gene from Literature | 836542 |