Detail of EST/Unigene AI974286 |
Acc. | AI974286 |
Internal Acc. | T110288e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=2e-56; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=2e-47; Beta-glucosidase 8 OS=Arabidopsis thaliana E-value=5e-41; Beta-glucosidase 32 OS=Oryza sativa subsp. japonica E-value=2e-40; Beta-glucosidase 20 OS=Oryza sativa subsp. japonica E-value=4e-40; |
Length | 440 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | AAAAATGTTTGACGGAATATACAGAAAGAAAAAAAACATAGACATAGAAGATGGAACCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |