| Detail of EST/Unigene AI974317 |
| Acc. | AI974317 |
| Internal Acc. | T110164e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=3e-20; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=4e-19; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=4e-19; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GLB OS=Nicotiana tabacum E-value=6e-19; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GGIB50 OS=Nicotiana tabacum E-value=6e-19; |
| Length | 414 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV0; |
| Sequence | CACTCATTCCATATCCCACCATGCATTGTATACTCATTCTTTCCATCCTCATTTCCTCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815130 |
| Trichome-related Gene from Literature | N/A |