| Detail of EST/Unigene AI974408 |
| Acc. | AI974408 |
| Internal Acc. | T110353e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ginkgo biloba E-value=8e-08; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Taxus baccata E-value=5e-07; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Pinus sylvestris E-value=1e-06; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ranunculus acris E-value=2e-06; |
| Length | 358 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV0; |
| Sequence | GTTCTTGCTCCTTTCACCTTCTCCAATGGCCGCTTCTTCTCTTCTCAGATCTGCCATCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.2.1.12 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844291 |
| Trichome-related Gene from Literature | N/A |