Detail of EST/Unigene AI974408 |
Acc. | AI974408 |
Internal Acc. | T110353e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ginkgo biloba E-value=8e-08; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Taxus baccata E-value=5e-07; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Pinus sylvestris E-value=1e-06; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Ranunculus acris E-value=2e-06; |
Length | 358 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | GTTCTTGCTCCTTTCACCTTCTCCAATGGCCGCTTCTTCTCTTCTCAGATCTGCCATCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.2.1.12 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844291 |
Trichome-related Gene from Literature | N/A |