Detail of EST/Unigene AI974494 |
Acc. | AI974494 |
Internal Acc. | T110444e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=1e-44; Cullin-2 OS=Arabidopsis thaliana E-value=1e-41; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=2e-41; Cullin-4 OS=Arabidopsis thaliana E-value=2e-13; Cullin-4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-13; |
Length | 329 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | CATGGATTTACTCCTTGGGTACCTGTAACATAAGTGGGAAATTTGACCCAAAAACCGTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03869 cullin 3; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10609 cullin 4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10609 cullin 4 |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825648 |
Trichome-related Gene from Literature | N/A |