| Detail of EST/Unigene AI974594 |
| Acc. | AI974594 |
| Internal Acc. | T113044e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=7e-23; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=1e-22; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=4e-22; Cysteine synthase OS=Citrullus lanatus E-value=8e-22; Cysteine synthase OS=Brassica juncea E-value=1e-21; |
| Length | 243 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | GCTTTCTTCATCAGATAACATGGAGCAACACTTTGCAATCAGAGAAGGATGTCACTCAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832872 |
| Trichome-related Gene from Literature | N/A |