| Detail of EST/Unigene AI974642 |
| Acc. | AI974642 |
| Internal Acc. | T113097e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=7e-10; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-09; Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=1e-08; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=2e-06; |
| Length | 328 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | TTTTTTTTTGACAACTCAAAAATCTGTGAACATAATTTATTACCTCATTTCTAATATGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825030 |
| Trichome-related Gene from Literature | N/A |