| Detail of EST/Unigene AJ416755 |
| Acc. | AJ416755 |
| Internal Acc. | |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative fucosyltransferase-like protein OS=Arabidopsis thaliana E-value=0; Glycoprotein 3-alpha-L-fucosyltransferase A OS=Arabidopsis thaliana E-value=0; Glycoprotein 3-alpha-L-fucosyltransferase A OS=Drosophila melanogaster E-value=3e-18; Alpha-(1,3)-fucosyltransferase OS=Pan troglodytes E-value=1e-17; Galactoside 3(4)-L-fucosyltransferase OS=Pan troglodytes E-value=2e-16; |
| Length | 658 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS (1 ESTs); |
| Sequence | TGAGAACAATATTGCCATGGCACGGCGGAGGGGATATCACATTGCAATGACAACCAGTCT |
| EST members of Unigene | AJ416755 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K00753 glycoprotein 3-alpha-L-fucosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko01031 Glycan structures - Biosynthesis 2 > K03663 4-galactosyl-N-acetylglucosaminide 3-alpha-L-fucosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K03663 4-galactosyl-N-acetylglucosaminide 3-alpha-L-fucosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko00601 Glycosphingolipid biosynthesis - lacto and neolacto series > K03663 4-galactosyl-N-acetylglucosaminide 3-alpha-L-fucosyltransferase |
| EC | 2.4.1.- 2.4.1.152 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44867.1.S1_at
|
| Corresponding NCBI Gene | 841394 |
| Trichome-related Gene from Literature | N/A |