Detail of EST/Unigene AJ496952 |
Acc. | AJ496952 |
Internal Acc. | AJ496952 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Troponin C OS=Tachypleus tridentatus E-value=2e-15; Troponin C, isoform 2 OS=Drosophila melanogaster E-value=1e-14; Troponin C, isoform 3 OS=Drosophila melanogaster E-value=2e-13; Troponin C, isoform 2 OS=Caenorhabditis elegans E-value=8e-13; Troponin C, isoform 2 OS=Balanus nubilis E-value=4e-11; |
Length | 277 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW (1 ESTs); |
Sequence | GACTCGGACGGTACGGGCAAGCTCACTTGACGCGTCGCAAAGTACCATCATTTCCTGACG |
EST members of Unigene | AJ496952 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.4324.1.S1_at
|
Corresponding NCBI Gene | 824198 |
Trichome-related Gene from Literature | N/A |