Detail of EST/Unigene AJ497216 |
Acc. | AJ497216 |
Internal Acc. | AJ497216 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome c1, heme protein, mitochondrial OS=Mus musculus E-value=9e-38; Cytochrome c1, heme protein, mitochondrial OS=Bos taurus E-value=4e-37; Cytochrome c1, heme protein, mitochondrial OS=Homo sapiens E-value=1e-36; Cytochrome c1, heme protein, mitochondrial OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=1e-33; Cytochrome c1, heme protein, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=4e-31; |
Length | 455 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW (1 ESTs); |
Sequence | GGATCTGATCTTTCCTTATAGCTGCTGCTCGCCACGAGGAGAGGATTACCTCTTCTCTCT |
EST members of Unigene | AJ497216 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K00413 ubiquinol-cytochrome c reductase cytochrome c1 subunit |
EC | 1.10.2.2 |
Transcription Factor Family | |
Transporter Classification Family | 3.D.3 Proton-translocating quinol-cyt c reductase superfamily QCR |
Probeset |
Mtr.4331.1.S1_at
|
Corresponding NCBI Gene | 834081 |
Trichome-related Gene from Literature | N/A |