Detail of EST/Unigene AJ498076 |
Acc. | AJ498076 |
Internal Acc. | AJ498076 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP], mitochondrial OS=Macaca fascicularis E-value=3e-34; Isocitrate dehydrogenase [NADP], mitochondrial OS=Homo sapiens E-value=3e-34; Isocitrate dehydrogenase [NADP] peroxisomal OS=Candida tropicalis E-value=8e-34; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-33; Isocitrate dehydrogenase [NADP], mitochondrial OS=Bos taurus E-value=1e-33; |
Length | 317 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTPOSE; |
Sequence | AAAATCAAAGTTGCCAATCCCATCGTTGAGATGGACGGAGATGAAATGACCCGTATGATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
EC | 1.1.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841875 |
Trichome-related Gene from Literature | N/A |