Detail of EST/Unigene AJ498128 |
Acc. | AJ498128 |
Internal Acc. | AJ498128 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Arabidopsis thaliana E-value=2e-42; Probable methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Dictyostelium discoideum E-value=2e-25; Methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Homo sapiens E-value=7e-25; Methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Rattus norvegicus E-value=3e-24; Methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS=Mus musculus E-value=3e-24; |
Length | 488 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTPOSE; |
Sequence | TTTCCTTTCCTAGCAGCACAACACAACCAAACGAGGATGTCGCAGCTTTCTATTCAACGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00031 Inositol metabolism > K00140 methylmalonate-semialdehyde dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00140 methylmalonate-semialdehyde dehydrogenase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00140 methylmalonate-semialdehyde dehydrogenase |
EC | 1.2.1.18 1.2.1.27 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815903 |
Trichome-related Gene from Literature | N/A |