Detail of EST/Unigene AJ498156 |
Acc. | AJ498156 |
Internal Acc. | AJ498156 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=9e-39; Chromoplast-specific carotenoid-associated protein, chromoplast OS=Cucumis sativus E-value=1e-36; Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=1e-36; Light-induced protein, chloroplastic OS=Solanum demissum E-value=1e-36; Plastid lipid-associated protein 1, chloroplastic OS=Brassica campestris E-value=2e-36; |
Length | 585 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTPOSE; |
Sequence | CTCTATCAAACCTAAACCAACTTCTCCATACAAACACTCTTCCAGTAACCTCTCTCAACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825714 |
Trichome-related Gene from Literature | N/A |