Detail of EST/Unigene AJ498519 |
Acc. | AJ498519 |
Internal Acc. | AJ498519 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=5e-93; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=1e-53; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=5e-43; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-42; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=5e-40; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTPOSE; |
Sequence | GGATAATAAATCGCGTTTACGGTTAATCCGTATCCGTTTTTTGCTTATCAGAGTGATCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |