| Detail of EST/Unigene AJ498624 |
| Acc. | AJ498624 |
| Internal Acc. | AJ498624 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Histone H3 OS=Urechis caupo E-value=1e-08; Histone H3 OS=Tigriopus californicus E-value=1e-08; Histone H3, embryonic OS=Strongylocentrotus purpuratus E-value=1e-08; Histone H3, embryonic OS=Strongylocentrotus droebachiensis E-value=1e-08; Histone H3, embryonic OS=Solaster stimpsoni E-value=1e-08; |
| Length | 170 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTPOSE; |
| Sequence | GATCACTCTCAATCTGAAATCACCAAAACACTTCAAGCTTTTCTGCTAGAAACCGTTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830164 |
| Trichome-related Gene from Literature | N/A |