| Detail of EST/Unigene AJ498858 |
| Acc. | AJ498858 |
| Internal Acc. | AJ498858 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide cyclase 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-41; Allene oxide cyclase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-40; Allene oxide cyclase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-38; Allene oxide cyclase 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-38; |
| Length | 547 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTPOSE; |
| Sequence | CTTCAAGCTATGCTTTGAGAACTATTCCATCGTCCTTTGTTAGACCAACTGCTTTTGCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837888 |
| Trichome-related Gene from Literature | N/A |