| Detail of EST/Unigene AJ499477 |
| Acc. | AJ499477 |
| Internal Acc. | AJ499477 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid cleavage dioxygenase 8, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; Beta,beta-carotene 9',10'-oxygenase OS=Homo sapiens E-value=4e-15; Beta,beta-carotene 9',10'-oxygenase OS=Macaca fascicularis E-value=7e-15; Beta,beta-carotene 9',10'-oxygenase OS=Mus musculus E-value=2e-14; Beta,beta-carotene 9',10'-oxygenase OS=Pongo abelii E-value=3e-14; |
| Length | 353 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM; |
| Sequence | GGTACTTCCATTATGGATTGCTATCAGCTTGCACTTATAGATGTAGAATGTTACTGTACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.99.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829417 |
| Trichome-related Gene from Literature | 829417 |