Detail of EST/Unigene AJ499762 |
Acc. | AJ499762 |
Internal Acc. | AJ499762 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Gemmatimonas aurantiaca (strain T-27 / DSM 14586 / JCM 11422 / NBRC 100505) E-value=4e-33; GMP synthase [glutamine-hydrolyzing] OS=Aquifex aeolicus (strain VF5) E-value=2e-32; GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1) E-value=4e-32; GMP synthase [glutamine-hydrolyzing] OS=Thermosipho melanesiensis (strain BI429 / DSM 12029) E-value=5e-32; GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon luteolum (strain DSM 273) E-value=6e-32; |
Length | 308 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM; |
Sequence | ACCAGTCTGCTGTCATTCCATCTTGACTTGTCACGGCTCTGAGTGCAACAACATGGGAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
EC | 6.3.5.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842670 |
Trichome-related Gene from Literature | N/A |