Detail of EST/Unigene AJ500068 |
Acc. | AJ500068 |
Internal Acc. | AJ500068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucuronate 4-epimerase 5 OS=Arabidopsis thaliana E-value=9e-91; UDP-glucuronate 4-epimerase 3 OS=Arabidopsis thaliana E-value=6e-89; UDP-glucuronate 4-epimerase 2 OS=Arabidopsis thaliana E-value=1e-88; UDP-glucuronate 4-epimerase 4 OS=Arabidopsis thaliana E-value=4e-86; UDP-glucuronate 4-epimerase 6 OS=Arabidopsis thaliana E-value=1e-81; |
Length | 548 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM; |
Sequence | ACTCTTTTTTGCCGTATCCAGAGCCCCTAAACAACCCTTAACAACATCATCAATGTATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
EC | 4.2.1.46 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826833 |
Trichome-related Gene from Literature | N/A |