| Detail of EST/Unigene AJ500271 |
| Acc. | AJ500271 |
| Internal Acc. | AJ500271 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Vesicle-associated membrane protein 724 OS=Arabidopsis thaliana E-value=5e-39; Vesicle-associated membrane protein 722 OS=Arabidopsis thaliana E-value=2e-31; Vesicle-associated membrane protein 725 OS=Arabidopsis thaliana E-value=3e-30; Vesicle-associated membrane protein 721 OS=Arabidopsis thaliana E-value=1e-28; Putative vesicle-associated membrane protein 726 OS=Arabidopsis thaliana E-value=4e-28; |
| Length | 553 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM; |
| Sequence | ACAAAAATTTTACAAAACATCCAATCATACTTTCACCATCTTCACCGCGTCGATAACTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04130 SNARE interactions in vesicular transport > K08512 vesicle-associated membrane protein 8 (endobrevin); Genetic Information Processing > Folding, Sorting and Degradation > ko04130 SNARE interactions in vesicular transport > K08513 vesicle-associated membrane protein 4; Genetic Information Processing > Folding, Sorting and Degradation > ko04130 SNARE interactions in vesicular transport > K08515 vesicle-associated membrane protein 7 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827258 |
| Trichome-related Gene from Literature | N/A |