| Detail of EST/Unigene AJ500714 |
| Acc. | AJ500714 |
| Internal Acc. | AJ500714 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase epsilon chain, chloroplastic OS=Medicago sativa E-value=6e-45; ATP synthase epsilon chain, chloroplastic OS=Amborella trichopoda E-value=3e-42; ATP synthase epsilon chain, chloroplastic OS=Arabidopsis thaliana E-value=3e-42; ATP synthase epsilon chain, chloroplastic OS=Helianthus annuus E-value=6e-42; ATP synthase epsilon chain, chloroplastic OS=Gossypium hirsutum E-value=6e-42; |
| Length | 412 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM; |
| Sequence | GCTGAACCAACTTGTTACGAGATCCTATTGATAGCCTCTACTCGTGTCCTAGCTCGTCGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |