Detail of EST/Unigene AJ500714 |
Acc. | AJ500714 |
Internal Acc. | AJ500714 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase epsilon chain, chloroplastic OS=Medicago sativa E-value=6e-45; ATP synthase epsilon chain, chloroplastic OS=Amborella trichopoda E-value=3e-42; ATP synthase epsilon chain, chloroplastic OS=Arabidopsis thaliana E-value=3e-42; ATP synthase epsilon chain, chloroplastic OS=Helianthus annuus E-value=6e-42; ATP synthase epsilon chain, chloroplastic OS=Gossypium hirsutum E-value=6e-42; |
Length | 412 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTGIM; |
Sequence | GCTGAACCAACTTGTTACGAGATCCTATTGATAGCCTCTACTCGTGTCCTAGCTCGTCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |