| Detail of EST/Unigene AJ500879 |
| Acc. | AJ500879 |
| Internal Acc. | AJ500879 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Gemmatimonas aurantiaca (strain T-27 / DSM 14586 / JCM 11422 / NBRC 100505) E-value=7e-34; GMP synthase [glutamine-hydrolyzing] OS=Aquifex aeolicus (strain VF5) E-value=2e-32; GMP synthase [glutamine-hydrolyzing] OS=Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009) E-value=4e-32; GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1) E-value=4e-32; GMP synthase [glutamine-hydrolyzing] OS=Thermosipho melanesiensis (strain BI429 / DSM 12029) E-value=5e-32; |
| Length | 311 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTGIM; |
| Sequence | GGTACCAGTCTGCTGTCATTCCATCTTGACTTGTCACGGCTCTGAGTGCAACAACATGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
| EC | 6.3.5.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842670 |
| Trichome-related Gene from Literature | N/A |