Detail of EST/Unigene AJ501150 |
Acc. | AJ501150 |
Internal Acc. | AJ501150 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP], chloroplastic (Fragment) OS=Medicago sativa E-value=1e-69; Isocitrate dehydrogenase [NADP] OS=Glycine max E-value=3e-66; Isocitrate dehydrogenase [NADP] OS=Nicotiana tabacum E-value=7e-63; Isocitrate dehydrogenase [NADP] OS=Solanum tuberosum E-value=7e-63; Isocitrate dehydrogenase [NADP], mitochondrial OS=Macaca fascicularis E-value=3e-55; |
Length | 398 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP; |
Sequence | CGCTTCTGATCACCACCATGGGATTCCAGAAAATCAAAGTTGCCAATCCCATCGTTGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
EC | 1.1.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841875 |
Trichome-related Gene from Literature | N/A |