| Detail of EST/Unigene AJ501160 |
| Acc. | AJ501160 |
| Internal Acc. | AJ501160 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable phytol kinase 3, chloroplastic OS=Glycine max E-value=1e-80; Probable phytol kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-64; Probable phytol kinase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-60; Probable phytol kinase 1, chloroplastic OS=Glycine max E-value=3e-39; Probable phytol kinase, chloroplastic OS=Triticum aestivum E-value=5e-37; |
| Length | 697 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAMP; |
| Sequence | GGATTAAGAGCATCAACAACATTAAATTTGACTCAATTCCCTCTGTTTCATCTCTCCCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835969 |
| Trichome-related Gene from Literature | N/A |