Detail of EST/Unigene AJ501419 |
Acc. | AJ501419 |
Internal Acc. | AJ501419 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=7e-68; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=6e-67; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=2e-65; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=3e-64; Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=1e-63; |
Length | 580 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP; |
Sequence | GACAGCCACACATTTCTTCTTCTTCCATAACAATTCATTCTTTTCTTTCTACTAGCCATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 844174 |
Trichome-related Gene from Literature | N/A |