| Detail of EST/Unigene AJ502194 |
| Acc. | AJ502194 |
| Internal Acc. | AJ502194 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial OS=Arabidopsis thaliana E-value=2e-40; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana sylvestris E-value=3e-39; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana tabacum E-value=5e-39; Probable phospholipid hydroperoxide glutathione peroxidase OS=Gossypium hirsutum E-value=7e-38; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=2e-37; |
| Length | 401 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAMP; |
| Sequence | TCCTTACTTCGCTTCTTCTCAATCTCTACTACTCTTCCAAACAAACCTATAATACATAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
| EC | 1.11.1.7 1.11.1.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826765 |
| Trichome-related Gene from Literature | N/A |