| Detail of EST/Unigene AJ502304 |
| Acc. | AJ502304 |
| Internal Acc. | AJ502304 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=7e-44; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=4e-37; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=9e-33; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-23; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-22; |
| Length | 456 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAMP; |
| Sequence | AGTGATAATGCTGTTTCTCACCTTTTCAGATTTGTTTATGCAAAGCTATGGTTTGGATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817295 |
| Trichome-related Gene from Literature | N/A |