Detail of EST/Unigene AJ502332 |
Acc. | AJ502332 |
Internal Acc. | AJ502332 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-35; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-29; NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=6e-25; NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=8e-16; Putative nitrogen fixation protein YutI OS=Bacillus subtilis (strain 168) E-value=2e-15; |
Length | 377 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP; |
Sequence | AACTGTCCTTCAACCTTCTTCTTTCACCAGAAAGGGCACGATGTTTTTTGGTACCAATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835057 |
Trichome-related Gene from Literature | N/A |