Detail of EST/Unigene AJ502429 |
Acc. | AJ502429 |
Internal Acc. | AJ502429 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=1e-24; (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=3e-24; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=1e-22; S-(+)-linalool synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-22; Tricyclene synthase 0e23, chloroplastic OS=Antirrhinum majus E-value=4e-18; |
Length | 357 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP; |
Sequence | GGTATAACAAAGGAGACAATTGATATCTTGGATGAAAAGTTTCCAAATGTCATATATTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842465 |
Trichome-related Gene from Literature | N/A |