| Detail of EST/Unigene AJ503454 |
| Acc. | AJ503454 |
| Internal Acc. | AJ503454 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 75B1 OS=Arabidopsis thaliana E-value=1e-35; UDP-glycosyltransferase 75D1 OS=Arabidopsis thaliana E-value=1e-34; UDP-glycosyltransferase 75C1 OS=Arabidopsis thaliana E-value=2e-34; UDP-glycosyltransferase 75B2 OS=Arabidopsis thaliana E-value=2e-33; UDP-glycosyltransferase 74E2 OS=Arabidopsis thaliana E-value=9e-33; |
| Length | 402 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAMP; |
| Sequence | GTGAAATGGTGTTCTCAAATGGAGATTCTTTCACATCCTTCATTGGGTTGTTTTTTGACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
| EC | 2.4.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837058 |
| Trichome-related Gene from Literature | N/A |