Detail of EST/Unigene AJ503503 |
Acc. | AJ503503 |
Internal Acc. | AJ503503 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=4e-53; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=9e-32; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=3e-31; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=6e-31; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-30; |
Length | 440 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP; |
Sequence | GGGGTGCTACGCTTGCAACTCATTTGGACAAACCTCGTCTTTACATGGGGTGCATGAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.1.134 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835415 |
Trichome-related Gene from Literature | N/A |