| Detail of EST/Unigene AJ503946 |
| Acc. | AJ503946 |
| Internal Acc. | AJ503946 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetate--CoA ligase ACS, chloroplastic/glyoxysomal OS=Arabidopsis thaliana E-value=9e-50; Acetyl-coenzyme A synthetase OS=Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003) E-value=7e-39; Acetyl-coenzyme A synthetase OS=Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIB 9529 / HD100) E-value=2e-38; Acetyl-coenzyme A synthetase OS=Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2) E-value=3e-38; Acetyl-coenzyme A synthetase OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=4e-38; |
| Length | 342 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAMP; |
| Sequence | AGAACTTTGTATGGTGATCATGAACGATACGAAACAACATATTTCAAGCCCTTTGCTGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
| EC | 6.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833655 |
| Trichome-related Gene from Literature | N/A |