| Detail of EST/Unigene AJ504119 |
| Acc. | AJ504119 |
| Internal Acc. | AJ504119 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-50; Replication factor C subunit 2 OS=Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) E-value=1e-49; Replication factor C subunit 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-49; Replication factor C subunit 4 OS=Homo sapiens E-value=7e-48; Probable replication factor C subunit 4 OS=Dictyostelium discoideum E-value=7e-48; |
| Length | 452 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAMP; |
| Sequence | GCCAATCATTCAGAGCACTCAACCATGGGTCGAGAAATACCGTCCAAAGCAAGTGAAAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838771 |
| Trichome-related Gene from Literature | N/A |