Detail of EST/Unigene AJ504226 |
Acc. | AJ504226 |
Internal Acc. | AJ504226 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial OS=Arabidopsis thaliana E-value=2e-42; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana sylvestris E-value=1e-40; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana tabacum E-value=2e-40; Probable phospholipid hydroperoxide glutathione peroxidase OS=Gossypium hirsutum E-value=3e-39; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=6e-39; |
Length | 487 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP; |
Sequence | GGGCTTTGTAGTACTTCAACAACAACTCGCATCCGATTCACTTCAACTACAAAACGTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.7 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826765 |
Trichome-related Gene from Literature | N/A |