Detail of EST/Unigene AJ547923 |
Acc. | AJ547923 |
Internal Acc. | AJ547923 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Licodione synthase OS=Glycyrrhiza echinata E-value=8e-55; 2-hydroxyisoflavanone synthase OS=Glycine max E-value=2e-25; Cytochrome P450 93A3 OS=Glycine max E-value=4e-25; Cytochrome P450 93A1 OS=Glycine max E-value=7e-24; Cytochrome P450 93A2 OS=Glycine max E-value=1e-20; |
Length | 492 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAPHEU; |
Sequence | CTTAGTAGCTCCTAAACCTCTTACACTAGCTTCAACATACCATGGAACCTCTACTATTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1 |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832584 |
Trichome-related Gene from Literature | N/A |