| Detail of EST/Unigene AJ548028 |
| Acc. | AJ548028 |
| Internal Acc. | AJ548028 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=3e-35; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=3e-35; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=6e-35; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=8e-35; Cytochrome P450 76A1 (Fragment) OS=Solanum melongena E-value=4e-34; |
| Length | 475 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTAPHEU; |
| Sequence | CAGAATCTAGTTTTTATTATTATTTATTGATCATGTCTATGTTTACTCACACTGCTATGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825276 |
| Trichome-related Gene from Literature | N/A |