Detail of EST/Unigene AJ548374 |
Acc. | AJ548374 |
Internal Acc. | AJ548374 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=6e-45; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=3e-43; Isoflavonoid 7-O-beta-apiosyl-glucoside beta-glycosidase OS=Dalbergia nigrescens E-value=6e-42; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=3e-40; Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=4e-40; |
Length | 509 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAPHEU; |
Sequence | GATTCTCATATTTCATATAAATCATTGAGTGACTTTCATATCACTTTTTTCTAATCCTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819052 |
Trichome-related Gene from Literature | N/A |