Detail of EST/Unigene AJ845571 |
Acc. | AJ845571 |
Internal Acc. | AJ845571 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=8e-11; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-09; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-08; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-08; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=4e-08; |
Length | 288 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtSNF; |
Sequence | GGGAAATAATAACTGCATGCTCTCTCTTCTCTTAGAAACAAAGCATCACCATAACATGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835611 |
Trichome-related Gene from Literature | N/A |