| Detail of EST/Unigene AJ845826 |
| Acc. | AJ845826 |
| Internal Acc. | AJ845826 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 93A2 OS=Glycine max E-value=1e-56; Cytochrome P450 93A3 OS=Glycine max E-value=2e-56; Cytochrome P450 93A1 OS=Glycine max E-value=9e-53; Beta-amyrin 24-hydroxylase OS=Glycine max E-value=3e-44; Licodione synthase OS=Glycyrrhiza echinata E-value=2e-42; |
| Length | 586 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtSNF; |
| Sequence | CAATCATGATTCAACGCTTCGAAATTTTATTGGATGTGGTGGACCGTTGCAGAGAATATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, |
| EC | 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830580 |
| Trichome-related Gene from Literature | N/A |