| Detail of EST/Unigene AJ845868 |
| Acc. | AJ845868 |
| Internal Acc. | AJ845868 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=1e-15; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=1e-12; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=3e-09; Glucan endo-1,3-beta-glucosidase (Fragment) OS=Glycine max E-value=4e-09; Glucan endo-1,3-beta-glucosidase, basic isoform 3 (Fragment) OS=Solanum tuberosum E-value=7e-09; |
| Length | 115 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtSNF; |
| Sequence | CTCCATCAGAGGGCCAACCACTCTCAGATACAACAACGTTCACCCAACCAATCCCGGTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |