| Detail of EST/Unigene AJ845937 |
| Acc. | AJ845937 |
| Internal Acc. | AJ845937 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-45; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-43; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=7e-43; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=1e-42; Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=2e-42; |
| Length | 555 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtSNF; |
| Sequence | TCGCTTATATTGGTGATAAGGTAAACATTCCTCTTGACTATGCTCTTTTTAGACAACAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |