Detail of EST/Unigene AJ845937 |
Acc. | AJ845937 |
Internal Acc. | AJ845937 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-45; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-43; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=7e-43; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=1e-42; Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=2e-42; |
Length | 555 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtSNF; |
Sequence | TCGCTTATATTGGTGATAAGGTAAACATTCCTCTTGACTATGCTCTTTTTAGACAACAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |