| Detail of EST/Unigene AJ848587 |
| Acc. | AJ848587 |
| Internal Acc. | AJ848587 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=7e-27; (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=9e-27; (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=9e-26; Myrcene synthase, chloroplastic OS=Quercus ilex E-value=2e-18; Tricyclene synthase 1e20, chloroplastic OS=Antirrhinum majus E-value=6e-18; |
| Length | 601 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtSN4 (1 ESTs); |
| Sequence | TTCACCTCCTTGTCTAGTCCAAGTTACTTTCCACCATTGTGGAAACTTCAATGGTTTCAT |
| EST members of Unigene | AJ848587 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8346.1.S1_x_at
|
| Corresponding NCBI Gene | 842465 |
| Trichome-related Gene from Literature | N/A |