| Detail of EST/Unigene AL365539 |
| Acc. | AL365539 |
| Internal Acc. | MtBA01A09R3 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=7e-16; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-15; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=2e-15; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=5e-15; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=3e-14; |
| Length | 494 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | GCTGCATTGCAGGTTGCAAAGAGGCCTGAAAATGAGGGAAAGCTTATTGGGGTTGTATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818978 |
| Trichome-related Gene from Literature | 818978 |