| Detail of EST/Unigene AL366147 |
| Acc. | AL366147 |
| Internal Acc. | MtBA05B08R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-amyrin 24-hydroxylase OS=Glycine max E-value=2e-34; Cytochrome P450 71B12 OS=Arabidopsis thaliana E-value=2e-11; Cytochrome P450 93A1 OS=Glycine max E-value=6e-11; Cytochrome P450 71B11 OS=Arabidopsis thaliana E-value=6e-11; Cytochrome P450 93A2 OS=Glycine max E-value=1e-10; |
| Length | 342 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA; |
| Sequence | AATTTGTTTAGCACTTTCAGCAGTTGATGCAACTACTACATGTTGTGAACCTAGCATAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832584 |
| Trichome-related Gene from Literature | N/A |