Detail of EST/Unigene AL366749 |
Acc. | AL366749 |
Internal Acc. | MtBA09H08R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin CPN60-2, mitochondrial OS=Cucurbita maxima E-value=2e-29; Chaperonin CPN60, mitochondrial OS=Arabidopsis thaliana E-value=8e-29; Chaperonin CPN60-like 1, mitochondrial OS=Arabidopsis thaliana E-value=3e-28; Chaperonin CPN60-1, mitochondrial OS=Cucurbita maxima E-value=9e-28; Chaperonin CPN60, mitochondrial OS=Brassica napus E-value=6e-27; |
Length | 505 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | TTGAGGGTGCGGTTGTTGTTGGTAAACTATTGGAACAGGATAATCCTGATCTTGGTTACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821983 |
Trichome-related Gene from Literature | N/A |