Detail of EST/Unigene AL366901 |
Acc. | AL366901 |
Internal Acc. | MtBA10H07F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=1e-61; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-61; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-61; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=5e-61; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=1e-60; |
Length | 346 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA; |
Sequence | AGTTCCCAGGTGACTACGGATGGGACACTGCTGGACTTTCTGCTGACCCAGAGACATTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |